An organophosphate insecticide methyl parathion (o- o- dimethyl o-4-nitrophenyl phosphorothioate) induces cytotoxic damage and tubular atrophy in the testis despite elevated testosterone level in the rat.

نویسندگان

  • Kilarkaje Narayana
  • Narayan Prashanthi
  • Arunkumar Nayanatara
  • Laxminarayana K Bairy
  • Urban J A D'Souza
چکیده

Methyl parathion (MP) is an organophosphate pesticide used in agriculture, although quite often illegally used indoors to contain insects. The present study was planned to investigate the effects of MP on rat testis. Adult male Wistar rats (13-14 weeks) were treated with MP as follows. Experiment 1-0, 1.75, 3.5 or 7 mg/kg i.p. for 5 days and sacrificed on Day 14; experiment 2 and 3- 0, 0.5, or 1 mg/kg i.p. for 12 days, and sacrificed on Days 130 and 77, respectively; experiment 4- 0, 0.75, or 1.5 mg/kg i.p. for 25 days, and sacrificed on Day 17; experiment 5- 0 or 3.5 mg/kg po for 25 days, and sacrificed on Day 17, after the last exposure. MP decreased the body weight and the testis weight in experiments 4 and 5 (p<0.05-0.001) due to decreased food intake and tubular atrophy respectively. MP increased the intra-testicular testosterone level and decreased the LH level in experiments 4 and 5. The seminiferous epithelium showed sloughing of germ cells, vacuoles, focal necrosis, and formation of multinucleated giant cells, cellular degeneration (nuclear pyknosis, halo appearance and shrinkage of nuclei) and tubular atrophy, especially in experiment 4. The degree of testicular damage was higher in experiment 4>5>1>3>2 indicating more effect of prolonged i.p. treatment. Homogenization-resistant spermatid count was decreased in experiments 1, 4 and 5, and MP also decreased the tubular diameter, and epithelial height (p<0.05-0.001). Incidences of stage XIV tubules, number of meiotic figures and elongating spermatids were also decreased, whereas the incidence of tubules showing epithelial sloughing increased (p<0.05-0.001). We conclude that MP is a reproductive toxicant in male rats which causes significant testicular damage in the testis.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Ameliorative effect of Zingiber officinale on diazinon -induced testicular toxicity: A biochemical, histopathological, and immunohistochemical study

Background and objectives: Diazinon (O,O-diethyl O-2-isopropyl-6- methyl pyrimidinyl-4-g-1- phosphorothioate) is one of  the organophosphate insecticides for different agricultural and gardening uses, which can be highly toxic. Zingiber officinale(ginger), a spice and herbal medicine, has antioxidant and anti-inflammatory properties. This study has investigated the eff...

متن کامل

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex.

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs...

متن کامل

Effects of pirimiphos-methyl (an organophosphate insecticide) on the fertility of adult male rats.

BACKGROUND Organophosphate insecticides represent one of the most widely used classes of pesticides with high potential for human exposure in both rural and residential environments. OBJECTIVE In the present study, we investigated the effects of pirimiphos-methyl (0, 2-diethylamino-6-methylpirimidin-4-yl O, O-dimethyl phosphorothioate), an organophosphothioate pesticide, on male rat reproduct...

متن کامل

Preparation of the novel zeolite AgX/CdO NPs composite catalyst and its application for the effective removal of fenitrothion (FN) from water

The novel zeolite AgX/CdO NPs composite catalyst has been fabricated under an ultrasound assisted dispersion route and identified by various analysis including FTIR, XRD, FESEM-EDAX, AFM, TEM, and EDAX-Dot mapping. Afterwards, for the first time, the zeolite AgX/CdO NPs composite has been exerted for the effective removal (adsorption and degradation) of fenitrothion (FN, O,O-dimethyl-O-(3-methy...

متن کامل

Preparation of the novel zeolite AgX/CdO NPs composite catalyst and its application for the effective removal of fenitrothion (FN) from water

The novel zeolite AgX/CdO NPs composite catalyst has been fabricated under an ultrasound assisted dispersion route and identified by various analysis including FTIR, XRD, FESEM-EDAX, AFM, TEM, and EDAX-Dot mapping. Afterwards, for the first time, the zeolite AgX/CdO NPs composite has been exerted for the effective removal (adsorption and degradation) of fenitrothion (FN, O,O-dimethyl-O-(3-methy...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • The Journal of toxicological sciences

دوره 31 3  شماره 

صفحات  -

تاریخ انتشار 2006